Make sure that you compile MetaCache with the right data type sizes so that you
See the installation instructions for more details.
MetaCache’s build mode is used for creating databases.
You need
If your machine doesn’t have enough RAM to fit an entire database you can use database partitioning to split up the reference genomes into several partitions.
As of version 2.6.0, a faster parallel database construction algorithm is used, however this can sometimes lead to slightly higher memory consumption. To switch back to the old construction scheme, you can supply command line option -threads 1.
You can download the NCBI’s taxonomy with an included helper script:
download-ncbi-taxonomy ncbi_taxonomy
This downloads the taxonomy and puts it in a folder called ncbi_taxonomy
Must be in FASTA or FASTQ format. If MetaCache was compiled with the zlib compression library (which is the default), the input files can also be compressed.
You can either specify all input genome files separately:
metacache build mydatabase genome1.fna genome2.fnq genome3.fa -taxonomy ncbi_taxonomy
or put them all in one folder and then use that folder as input source:
metacache build mydatabase genomes_folder -taxonomy ncbi_taxonomy
There are three ways for MetaCache to obtain the taxon of a reference genome.
assembly_summary.txt filesMetaCache looks for a file named assembly_summary.txt (as used by the NCBI) in each reference genome input folder.
Such files map reference genome filenames to taxon ids, so that all sequences in a reference genome file get the same taxid.
A proper assembly_summary.txt file must contain at least:
## and all column names separated by tabstaxid (and contain the taxon ids)Example:
# first comment line needs to be there
# assembly_accession taxid
filename1 438753
filename2 198804
...
>NC_017430.1 | taxid|813
GCGGCCGCCCGGGAAATTGCTAAAAGATGGGAGCAAAGAGTTAGAGATCTACAAGATAAAGGTGCTGCACGAAAATTATT
...
MetaCache looks for such annotations by default, so this does just work.
accession2taxid tab-separated filesThe NCBI’s accession to taxon mapping files can be downloaded with the included helper script download-ncbi-taxmaps.
You should put them into the same folder as the taxonomy:
download-ncbi-taxmaps taxonomy_folder
MetaCache looks in the taxonomy folder (determined by build option -taxonomy) for them. They are used at the end of the database build phase for all reference sequences that don’t have a taxid assigned yet (by any of the other methods).
accession2taxid files contain 4 tab-separated columns:
accession accession_version taxid gid
A00002 A00002.1 9913 0
A00003 A00003.1 9913 0
X52700 X52700.1 9771 0
...
The mappings file name(s) go after the parameter -taxpostmap:
metacache build mydb mygenomes_folder -taxonomy ncbi_taxonomy -taxpostmap mymap.accession2taxid
In order for this to work the accession or accession.version must be contained as sequence id in the
reference genome FASTA or FASTQ files:
>NZ_AAGY02000218.1 Streptococcus pneumoniae TIGR4 ctg00649, whole genome shotgun sequence
TTTGAGCCACTTCGTCTTTAACGGCTTTATTCATAAGCTCTTGTAATTTTTCTTTACTATCAATTACTTCTGATTTTCCG
...
If your genomes are already annotated with taxon ids (see section 2) and/or you also have assembly_summary.txt with taxon ids in the genomes folder, than these taxon ids are used with higher priority.
In case you want the taxon ids from accession2taxid files to supersede those from other sources you can supply the option -reset-taxa.
metacache build mydb mygenomes_folder -taxonomy ncbi_taxonomy -reset-taxa -taxpostmap mymap.accession2taxid